zona3
zona5-zona6

Dal sequenziamento del DNA alla scoperta della reazione polimerasica a catena

Print Friendly, PDF & Email

di Sergio Barocci

Le tappe storiche del sequenziamento di 1° generazione

A partire dagli anni ’70 del secolo scorso, incominciano a svilupparsi dei filoni di ricerca molto importanti, finalizzati al sequenziamento del DNA.  F. Sanger nel 1977 già premio Nobel per aver inventato il  sequenziamento delle proteine, sviluppa un nuovo ed efficiente metodo per sequenziare il DNA mediante interruzione controllata della sua replicazione.  Sempre nello stesso anno, contemporaneamente a F. Sanger, W. Gilbert e A. Maxam inventano un metodo analogo basato però su tagli specifici.  Nel 1978, poco dopo, viene messa a punto la tecnica dell’elettroforesi  utile per confrontare  frammenti diversi di DNA .
La conoscenza delle sequenze di DNA incomincia così a diventare  indispensabile per la ricerca biologica di base ma anche in numerosi campi  applicati come la  diagnostica, le biotecnologie , la  biologia forense , e la  biologia  sistematica .
sequenziamento del DNASequenziare  significa determinare il giusto ordine dei nucleotidi nella molecola del DNA.  Qualche volta,  il sequenziamento viene confuso con  la “decifrazione” del DNA  ma in realtà  è solo il primo passo in questa direzione, per quanto importante. Dopo avere eseguito il sequenziamento di   una molecola di DNA, occorre infatti   studiarla per capire cosa significhino le sequenze identificate. Nel DNA sono presenti  4 tipi  di nucleotidi, contenenti una delle basi: A, G, C, T.   A e G sono purine, C e T sono pirimidine. Se si dispone di  un frammento di DNA di 300 nucleotidi e se ne  voglia determinare la sequenza, significa che si desidera  comprendere, nell’ordine esatto, quali sono i 300 nucleotidi.
Alla fine del sequenziamento si ottiene un insieme di lettere, es. AAGTGTGTCTGTCAGTTCTAGAACC…, apparentemente prive di significato, in realtà a seconda dello studio che si sta effettuando avranno un proprio significato.
Il sequenziamento del DNA mediante tagli specifici : il metodo di Maxam – Gilbert

Il metodo di taglio chimico  sviluppato nel  1977  da Allan Maxam (1945 – ) e Walter Gilbert, è una tecnica non automatizzabile che prevede la marcatura delle estremità 3′ del DNA con 32P, il taglio e la separazione dei due filamenti marcati. La miscela ottenuta viene suddivisa in quattro parti, ciascuna delle quali produce una miscela di frammenti dopo trattamento chimico capace di modificare e tagliare specificamente una o piu’ basi.  I frammenti marcati prodotti hanno dimensioni specifiche e vengono analizzati per elettroforesi per determinare l’ordine dei nucleotidi. Questo metodo  molto impiegato in passato, ora è  invece  poco utilizzato, perché non adatto al  sequenziamento  automatico e perché utilizza composti chimici dannosi alla salute.

Reazione di sequenziamento di Maxam–Gilbert

Reazione di sequenziamento di Maxam–Gilbert

 

Il sequenziamento del DNA mediante  interruzione controllata della replicazione : metodo di Sanger

(sinistra) Frederick Sanger ;  (destra) Walter Gilbert

(sinistra) Frederick Sanger ; (destra) Walter Gilbert

Frederick Sanger (1918–2013) è stato un biochimico britannico, quarta persona nella storia ad essere premiata con due Premi Nobel. Nobel per la chimica 1958 ; Nobel per la chimica 1980.

Walter Gilbert (1932 –  ) è un biochimico  statunitense  e  premio Nobel per la chimica insieme con Frederick Sanger “per i loro contributi riguardanti la determinazione delle sequenze di basi negli acidi nucleici”

Si tratta di una  sintesi enzimatica parziale di una copia del DNA stampo in presenza di dideossinucleotidi (ddNTPs) che causano la terminazione dell’allungamento. I frammenti ottenuti (fino a 500-1000 bp) vengono separati mediante elettroforesi su gel di poliacrilammide e visualizzati per autoradiografia.
F. Sanger  osservando  la DNA polimerasi all’opera riuscì a comprendere  come poteva sviluppare il  metodo per sequenziare  il DNA. L’unico ingrediente che dovette aggiungere furono dei nucleotidi particolari, chiamati dideossinucleotidi cioè molecole che presentano  una modifica chimica tale per cui, una volta che vengono inserite nella catena nascente di DNA, ne interrompono la sintesi. La polimerasi non riesce più ad aggiungere altri nucleotidi, e rilascia così un frammento “monco”. A questo punto occorreva  fare due cose: misurare la lunghezza di questo frammento e riconoscere il dideossinucleotide che si era legato per ultimo. Con queste due informazioni in mano leggere la sequenza diventa immediato. Se ad esempio otteniamo  un frammento lungo 10 nucleotidi dove l’ultimo nucleotide aggiunto è una G,  sappiamo   che in  decima  posizione esiste  una G.
Un tempo per fare questo si eseguivano sullo stesso DNA  quattro reazioni separate, per ognuna delle quali veniva  utilizzato  un dideossinucleotide diverso: ddATP, ddCTP, ddGTP e ddTTP.  Al termine della reazione, si prendevano i frammenti generati da ogni reazione che venivano  poi  misurati  mediante un’elettroforesi su gel. In questo gel, le molecole più lunghe si muovono più lentamente e tutti i frammenti possono quindi essere separati. Al termine, si procedeva a  ricostruire  la sequenza.

metodo di Sanger per il sequenziamento del DNA

metodo di Sanger per il sequenziamento del DNA

L’invenzione di questa  metodologia  di  sequenziamento  ha segnato una svolta epocale nel campo della biologia molecolare e  ciò è stato  dimostrato dal fatto che F. Sanger ricevette per questo motivo il premio Nobel per la Chimica nel 1980..
L’attenzione dei ricercatori incominciò a focalizzarsi su singoli geni o tutt’al più  sui geni di un singolo operone. Tale  approccio era  logico e necessario.  Logico perché, nell’affrontare un nuovo campo di studio era   buona norma incominciare dai casi più semplici e  necessario perché  le  tecnologie di  quegli anni non consentivano di analizzare insiemi più complessi di geni.  Cosi  verso la  fine degli anni’70  diventò  possibile sequenziare  il DNA dei virus. Tuttavia,  le tecniche di sequenziamento manuale utilizzate per i virus,  non erano però sufficienti per far luce sul genoma dei procarioti e degli eucarioti, i più piccoli dei quali  erano  centinaia di volte più grandi di quello di un batteriofago. In più, la tecnica era molto costosa ed è per questo che  si passò   successivamente negli anni a venire  a tecnologie di sequenziamento  molto più efficienti ed economiche.
Riassumendo,  per il  sequenziamento  secondo Sanger, si preparano delle miscele  in quattro provette, che sono costituite da:

  • il campione di DNA che si vuole sequenziare a singolo filamento,
  • la DNA polimerasi,
  • un primer marcato con estremità 3’OH libera,
  • i quattro tipi di deossinucleotidi trifosfato normali (dNTP) marcati con 32P o 35S

deossi- e dideossinucleotidiInfine,  in ogni provetta viene aggiunto uno specifico tipo di dideossinucleotidi trifosfato (ddNTP), in una provetta ddA, in un’altra ddG, in un’altra ddC ed in un’altra ddT, i ddNTP sono la chiave del successo di questa tecnica.
Si verifica che il primer complementa con il filamento stampo e viene esteso dalla DNA polimerasi, questa infatti aggiunge all’estremità libera del primer i nucleotidi complementari al filamento stampo, cioè i dNTP, invece di aggiungere un dNTP di tanto in tanto può accadere che aggiunge un ddNTP. Con l’incorporazione del ddNTP la sintesi del filamento complementare si ferma poiché i ddNTP non permettono la formazione del legame con il successivo nucleotide trifosfato.  I dNTP hanno un 3’OH nel  desossiribosio che consente l’aggiunta di nucleotidi, i ddNTP  invece hanno un 3’-H che non consente l’aggiunta di ulteriori nucleotidi e per questo la sintesi del DNA termina.

gel di poliacrilammide di una sequenza

gel di poliacrilammide di una sequenza

La stessa cosa accade per tutti i frammenti di ciascuna provetta ossia  si verifica  la sintesi del filamento complementare fino a che non viene incorporato un ddNTP.  Si ottengono in questo modo frammenti di DNA di varia lunghezza, che differiscono da provetta a provetta per il tipo di ddNTP con il quale terminano. I campioni marcati contenuti nelle quattro miscele  vengono poi denaturati al calore e caricati in un gel di poliacrilammide in quattro pozzetti diversi . L’elettroforesi viene realizzata a  70°C  in presenza di urea in modo da impedire la rinaturazione del DNA.  Con l’elettroforesi,  i frammenti migrano in base alla dimensione e quindi al termine della elettroforesi, attraverso l’ autoradiografia,  è possibile risalire alla sequenza. In  un gel ottenuto con il metodo di Sanger  la sequenza viene letta dal basso del gel verso l’alto. Nella prima corsia elettroforetica (A), si osservano tre  bande. Ciò  significa che in quelle posizioni è stato incorporato un  ddATP e quindi  in quelle tre  posizioni esiste  una A nella sequenza. Si procede con lo stesso ragionamento per le altre tre  corsie elettroforetiche che sono indici di  posizionamento dei nucleotidi C, T, G.
Nel  1987  incominciano a svilupparsi  le prime apparecchiature  per il   sequenziamento automatico  che impiegano  sistemi per la rilevazione della fluorescenza (Applied Biosystems) .
In questo modo  si è potuto  conoscere  la sequenza di diversi   procarioti.

La conoscenza di queste sequenze ha così permesso di chiarire sia il modo in cui questi organismi ripartiscono fra i propri geni i vari compiti cellulari e  sia   le modalità di attuazione delle loro funzioni specializzate.
La novità di questi primi  sequenziatori automatici  è stata quella di creare un’ unica miscela di reazione, etichettando ogni base azotata con una molecola fluorescente di colore diverso. La sintesi dei filamenti procede come già descritto in precedenza ma in questa tecnologia  vengono incorporati, per terminare la sequenza,  ddNTP marcati con  fluorocromi  diversi.
I prodotti di sintesi sono  fatti correre sulla  stessa corsia di un gel denaturante;  un laser eccita i fluorocromi,  ciascuno dei quali emette una luce d’onda caratteristica e tramite un sistema automatizzato viene riportata su un  computer la corretta sequenza nucleotidica del frammento analizzato.

uno dei primi sequenziatori automatici: il 370A  di  Applied Biosystems costruito nel 1987

uno dei primi sequenziatori automatici: il 370A di Applied Biosystems costruito nel 1987

La procedura è completamente automatizzata ed in questo modo si ha un grosso risparmio in termini di tempo, poiché si possono analizzare più campioni simultaneamente.

 

 

 

 

K. Mullis e la Polymerase Chain Reaction  o  PCR

Intorno alla metà degli anni ’80 Kary Mullis rivoluziona la genetica molecolare ideando la PCR o Polymerase Chain Reaction, una  metodologia di ricerca in grado di produrre un numero elevato di copie di una specifica sequenza di DNA genomico  utilizzando  il frammento Klenow della DNA polimerasi I di Escherichia Coli, rendendo possibile  un tipo di approccio del tutto nuovo  per lo studio e l’analisi dei geni

schema di sequenziamento automatico del DNA

schema di sequenziamento automatico del DNA

Le basi teoriche della PCR  erano state  probabilmente  già descritte negli anni ’70  da K. Kleppe in un articolo, apparso sulla rivista J. Mol. Biol, dal titolo  “Repair replication of short synthetic DNA’s as catalyzed by DNA polymerase” ma  la tecnica della PCR  incominciò  a suscitare   particolare interesse solo dopo la descrizione di K. Mullis avvenuta nel 1983.
K.  Mullis   racconta  di aver escogitato questa tecnica  in circostanze inconsuete  una sera in auto al chiaro di luna : “un venerdì sera nell’aprile del 1983 mentre al volante della mia automobile procedevo lungo una serpeggiante strada di montagna  illuminata dalla luna, nella regione ricca di boschi di sequoie della California settentrionale; …..  ebbi una specie di rivelazione : escogitai un processo che poteva produrre un numero illimitato di copie di geni”.
La cosa più buffa è che i concetti che  stanno  alla base della PCR ,  oggi considerati ovvi,   e tutte le informazioni scientifiche necessarie erano già  note da diversi anni.
La  PCR è stata utilizzata dagli organismi viventi sin dal momento in cui essi si sono evoluti nel brodo primordiale sulla superficie del  nostro pianeta  3,5 miliardi di anni fa.
Questa tecnica , fa in provetta ciò che qualunque batterio farebbe in un brodo di coltura e su una piastra di agar e che ogni cellula del nostro corpo svolge ogni giorno. Noi tutti produciamo miliardi di copie esatte del nostro DNA amplificandolo milioni di volte.
La reazione di PCR  è ’ altamente sensibile e specifica; essa  permette la sintesi in vitro di segmenti  di DNA bicatenario e  l’amplificazione della sequenza target milioni di volte in poche ore.  Per tale  motivo viene anche definita “amplificazione genica”.

Kary Banks Mullis

Kary Banks Mullis

Kary Banks Mullis (1944  –  ) biochimico statunitense e Premio Nobel nel 1993 per la chimica per aver inventato  la  reazione a catena polimerasica  o  polymerase chain  reaction  (PCR).  “Sometimes a good idea comes to you when you are not looking for it”, cosi inizia una sua pubblicazione del 1990.  Tale reazione lega in modo specifico e amplifica una singola  sequenza all’ interno di una miscela complessa di DNA e si basa sulle regole fondamentali della replicazione in vivo: uno stampo di DNA, desossinucleotidi,  primers,  DNA- polimerasi. La PCR non è altro che  una replicazione del  DNA in provetta.

Ma la vera rivoluzione avviene quando vengono purificate e rese disponibili le prime DNA polimerasi termostabili che innalzano notevolmente l’efficienza fornendo anche la possibilità di automatizzare in seguito la reazione senza dover aggiungere ad ogni ciclo l’enzima fresco.
La DNA- polimerasi, l’enzima del DNA,  era stata scoperta alla fine degli anni ’50 da A. Kornberg ed era noto da tempo che questo enzima richiedeva una corta sequenza di DNA o RNA a doppio filamento  chiamata “primer” per iniziare la replicazione del DNA.  La genialità di Mullis sta nell’aver pensato che “ mescolando tutti i componenti in una provetta contenente una sola molecola di DNA , si potesse replicare e amplificare questa molecola di DNA milioni di volte in un breve tempo”.  I componenti di cui parlava  Mullis sono:

  1. un campione contenente il DNA –bersaglio che si intende amplificare ( in teoria occorre una sola molecola);
  2. una copia di corti primer di DNA a singolo filamento;
  3. i quattro nucleotidi trifosfati ( ATP,GTP,CTP,TTP);
  4. l’enzima DNA-polimerasi;
  5. un tampone contenente ioni Mg++, necessari per il funzionamento della DNA – polimerasi.

 

Il DNA bersaglio

In genere, si tratta di DNA genomico. Perché l’amplificazione mediante PCR possa avvenire è necessario che il cromosoma venga despiralizzato e gli istoni e le altre proteine associate con la struttura cromosomica devono essere rimosse. Di norma, nella PCR , il DNA-stampo viene utilizzato già purificato , in quanto proteine, lipidi e  carboidrati vengono rimossi nella fase di estrazione . Perché i primer possano legarsi al DNA – bersaglio e la DNA –polimerasi svolgere il suo compito occorre solo denaturare cioè separare  i due filamenti del DNA – bersaglio. Era già ben noto nel 1983 che il calore permette di separare i filamenti di DNA e che i filamenti complementari si riuniscono per appaiamento delle basi complementari quando la temperatura diminuisce. Per cui, cosa fece Mullis?  Riscaldò la sua miscela di DNA- bersaglio, primer e nucleotidi a circa 90°C per pochi minuti, poi abbassò la temperatura abbastanza da permettere ai primer , corti e presenti in largo eccesso, di legarsi (annealing) alle rispettive sequenze complementari nel DNA – bersaglio.  A questo punto, Mullis, aggiunse la DNA polimerasi e lasciò procedere la reazione di polimerizzazione con i nucleotidi trifosfati. In questo modo, la DNA – polimerasi riempì la porzione mancante di ogni filamento producendo due nuove regioni a doppio filamento di DNA.  Il processo poteva essere ripetuto un’infinità di volte , producendo ad ogni ciclo un numero doppio di molecole di DNA in pochissimi minuti. Poichè la DNA – polimerasi viene distrutta dal calore , originariamente era necessario aggiungere l’enzima ad ogni ciclo. Il problema fu in seguito risolto utilizzando DNA – polimerasi resistenti al calore.

I  primers

Sono due corte sequenze di nucleotidi, in genere in numero di  18 -20 basi . La sequenza dei due primer deve essere esattamente complementare a due regioni corrispondenti all’estremità 3’ dei due filamenti del frammento di DNA che si intende amplificare.

 

La PCR

schema di PCR a scopo preparativo

schema di PCR a scopo preparativo

Il principio a cui si ispira la PCR è la replicazione del DNA.  La  PCR  è  attualmente  la metodica più  comunemente impiegata tra tutte le tecniche di biologia molecolare, grazie alla particolare sensibilità , specificità  e semplicità   operativa.  Questa tecnologia ha permesso di procedere ad esperimenti che prima erano impossibili e ha numerose applicazioni nel campo della ricerca di base e della diagnostica. Si puoʼ usare a scopo preparativo (il DNA viene utilizzato in applicazioni successive, es. clonaggio), oppure analitico (si vuole valutare la presenza o assenza di una certo DNA, es. lavoro di ricerca, tecniche diagnostiche, tecniche forensi).
La PCR a scopo preparativo si può usare per produrre DNA ricombinante  a partire da DNA genomico o da mRNA.

Mentre  la PCR a scopo diagnostico si può usare per individuare la presenza di agenti patogeni e a scopo forense si può invece utilizzare per identificare individui presenti sulla scena di un crimine.

L’applicazione corretta di questo potente strumento diagnostico necessita di una solida conoscenza dei principi di base delle procedure di manipolazione degli acidi nucleici, e dei possibili inconvenienti e pericoli che si incontrano durante le fasi analitiche che conducono al risultato mediante la tecnica di PCR.
La PCR si basa su cicli ripetuti di denaturazione del DNA, ibridazione e polimerizzazione.  Per la PCR si usano DNA polimerasi termostabili, che rimangono stabili alle temperature di denaturazione del DNA.

applicazione della PCR a scopo diagnostico

applicazione della PCR a scopo diagnostico

 

I principi base della PCR

Non esiste un protocollo unico che vada bene per tutte le reazioni di PCR. Ogni nuova reazione va ottimizzata sperimentalmente. Per ottimizzare la reazione, è importante avere ben chiaro il modo in cui i vari aspetti della reazione influenzano il risultato. Nella PCR si possono distinguere fondamentalmente due fasi :
1. una fase di screening durante i primi cicli in cui il frammento di DNA viene selezionato con il legame specifico dei primer,
2. una fase di amplificazione in cui il numero delle coppie del frammento desiderato viene incrementato esponenzialmente

La PCR si basa su cicli ripetuti di denaturazione del DNA, ibridazione e polimerizzazione.  Per la PCR si usano DNA polimerasi termostabili, che rimangono stabili alle temperature di denaturazione del DNA

La PCR si basa su cicli ripetuti di denaturazione del DNA, ibridazione e polimerizzazione. Per la PCR si usano DNA polimerasi termostabili, che rimangono stabili alle temperature di denaturazione del DNA

Tutti i cicli della PCR iniziano con una tappa di denaturazione del DNA stampo e di tutti i prodotti di amplificazione generati nei cicli precedenti. Normalmente, si utilizza una temperatura di denaturazione di 94°C. Quando la temperatura si abbassa, i primer si legano (annealing) allo stampo complementare (template). Nei primi cicli i primer devono cercare e riconoscere nel DNA genomico il bersaglio corretto. Dopo l’annealing dei primer, la DNA – polimerasi si lega al complesso primer- template ed utilizzando i dNTP presenti nella miscela di reazione allunga il primer seguendo come stampo il template. Durante i cicli intermedi, i prodotti di amplificazione generati nei cicli precedenti diventano il template preponderante rispetto al DNA genomico. Negli ultimi cicli, i prodotti di amplificazione sono talmente concentrati che si legano tra di loro, impedendo ai primer di trovare i loro siti complementari. La forza principale che regola la PCR e la fa procedere è l’eccesso molare dei reagenti rispetto al template. Il rapporto fra reagenti e template è elevato durante i primi cicli ma diminuisce con il procedere della reazione a causa dell’accumulo di prodotti amplificati.

 

 

Lascia un commento

Il tuo indirizzo email non sarà pubblicato. I campi obbligatori sono contrassegnati *

Sostieni la divulgazione della Chimica
Il tuo libero contributo sarà interamente devoluto alle attività di divulgazione della Chimica.
zona1




CONDIVIDI QUESTO ARTICOLO
RICHIEDI LA NEWSLETTER
Una mail settimanale con gli aggiornamenti delle pubblicazioni, le attività dell'Associazione e le novità del mondo della divulgazione chimica
SEGUI CHIMICARE ANCHE SU FACEBOOK
segui chimicare anche su facebook
ARTICOLI RECENTI
ARCHIVIO ARTICOLI PER MESE
SEGUI CHIMICARE ANCHE SU TWITTER
Non solo gli aggiornamenti degli articoli pubblicati sui nostri blog e le novità del Carnevale della Chimica, ma anche le segnalazioni dei migliori interventi di divulgazione chimica in lingua italiana nel web.